Review



oligo d t 25 magnetic beads  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    New England Biolabs oligo d t 25 magnetic beads
    Oligo D T 25 Magnetic Beads, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 979 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/oligo+d+t+25+magnetic+beads/Oligo+dT25+Mag+Beads/pm42120494-319-8-13
    Average 98 stars, based on 979 article reviews
    oligo d t 25 magnetic beads - by Bioz Stars, 2026-10
    98/100 stars

    Images

    Related Articles

    Magnetic Beads:

    Article Title: Phytochrome B and the methyltransferase complex coordinately regulate N 6 -methyladenosine RNA modifications and shade avoidance responses in Arabidopsis.
    Article Snippet: Total RNA was extracted from 623 Arabidopsis seedlings using a RNeasy Plant Mini Kit (Qiagen). .. Poly(A) RNA 624 was enriched using Oligo d(T)25 magnetic beads (New England Biolabs, USA). ..

    Article Title: TOR-dependent regulation of the yeast homolog of the juvenile Batten Disease-associated gene CLN3
    Article Snippet: The RNA concentration was measured using a NanoDrop spectrophotometer (ThermoFisher Scientific) at 260 nm. .. Poly-A RNA was isolated from a total of 80 μ g of RNA using oligo d(T)25 magnetic beads (New England Biolabs, 61002), following the protocol and kit purchased from New England Biolabs (S1550). ..

    Article Title: CCDC174 deficiency impaired human fertility by affecting the alternative splicing of maternal mRNAs.
    Article Snippet: Cells were lysed in NP-40 lysis buffer (50mM Tris, 150mM NaCl, 0.5% NP-40, pH 7.5) with 1% protease inhibitor cocktail (B14001, Bimake) and RNase inhibitor. .. Equal amounts of protein extracts were incubated with Oligo d(T)25 magnetic beads (S1419S, New England BioLabs). ..

    Article Title: Non-gonadal PIWIL1/Aubergine drives regenerative and tumorigenic stem cell proliferation and tumorigenesis in the intestine.
    Article Snippet: .. Polyadenylated RNA was purified from the DNase-treated total RNA using the oligo d(T)25 magnetic beads (NEB, S1419) and used for the library preparation. .. Libraries were cloned using the NEBNext Ultra Directional II RNA Library Prep Kit for Illumina (NEB, E7760), following the manufacturer’s instruction, and amplified by KAPA polymerase using the same primers as for the small RNA sequencing.

    Article Title: RNA functional modulation by Mitoxantrone via RNA structural ensemble repartitioning.
    Article Snippet: .. For SHAPE-MaP library preparation, ~50 ng poly(A)+ RNA, enriched using Oligo d(T)25 Magnetic Beads (cat. S1419S, New England Biolabs), were directly eluted from the beads by fragmentation in 4 mM MgCl2 for 5.5 min at 94°C, and then cleaned up on Monarch® Spin RNA Cleanup columns. ..

    Article Title: The kinase CRK5 regulates dark-induced senescence and dissipation of energy as heat by inhibiting salicylic acid signaling.
    Article Snippet: 18 CYSTEINE-RICH RECEPTOR-LIKE KINASE 5 (CRK5) is a membrane-localized signaling 19 protein implicated in developmental and stress-responsive pathways.. Its promoter contains 20 multiple W-box motifs, suggesting regulation by WRKY transcription factors and a potential role 21 in salicylic acid (SA)-dependent signaling.. Since SA simultaneously promotes dark-induced 22 senescence and modulates photo-protective dissipation of absorbed energy in excess (AEE) as heat 23 through its effects on non-photochemical quenching (NPQ), stomatal behavior, and leaf 24 temperature, how these SA-driven processes are coordinated remains unclear.

    Article Title: Regulatory landscapes and structural choreography of transcription initiation in spirochetes
    Article Snippet: .. Polyadenylated RNAs were then bound to Oligo-d(T)25 magnetic beads (NEB) in the presence of 0.5 M LiCl and treated with RppH (RNA pyrophosphohydrolase, NEB) to convert 5’ triphosphate moieties into single phosphate moieties. .. A 24 nt RNA adapter (CACACGCACACACAACCAGAGGAG) was then ligated to the 5’ ends of the product RNAs by T4 RNA ligase I (NEB) in the presence of 12.5% (v/v) PEG.

    Article Title: CRK5 preserves antioxidant homeostasis and prevents cell death during dark-induced senescence through inhibiting the salicylic acid signaling pathway
    Article Snippet: .. Frozen leaves were ground using a mortar and pestle in liquid nitrogen, and RNA was isolated using the SpectrumTM Plant Total RNA Kit (Sigma, St. Louis, MO, USA). mRNA fraction was isolated using Oligo d(T)25 Magnetic Beads (NEB, S1419S) from 20 ug of total RNA. ..

    Isolation:

    Article Title: TOR-dependent regulation of the yeast homolog of the juvenile Batten Disease-associated gene CLN3
    Article Snippet: The RNA concentration was measured using a NanoDrop spectrophotometer (ThermoFisher Scientific) at 260 nm. .. Poly-A RNA was isolated from a total of 80 μ g of RNA using oligo d(T)25 magnetic beads (New England Biolabs, 61002), following the protocol and kit purchased from New England Biolabs (S1550). ..

    Article Title: The kinase CRK5 regulates dark-induced senescence and dissipation of energy as heat by inhibiting salicylic acid signaling.
    Article Snippet: 18 CYSTEINE-RICH RECEPTOR-LIKE KINASE 5 (CRK5) is a membrane-localized signaling 19 protein implicated in developmental and stress-responsive pathways.. Its promoter contains 20 multiple W-box motifs, suggesting regulation by WRKY transcription factors and a potential role 21 in salicylic acid (SA)-dependent signaling.. Since SA simultaneously promotes dark-induced 22 senescence and modulates photo-protective dissipation of absorbed energy in excess (AEE) as heat 23 through its effects on non-photochemical quenching (NPQ), stomatal behavior, and leaf 24 temperature, how these SA-driven processes are coordinated remains unclear.

    Article Title: CRK5 preserves antioxidant homeostasis and prevents cell death during dark-induced senescence through inhibiting the salicylic acid signaling pathway
    Article Snippet: .. Frozen leaves were ground using a mortar and pestle in liquid nitrogen, and RNA was isolated using the SpectrumTM Plant Total RNA Kit (Sigma, St. Louis, MO, USA). mRNA fraction was isolated using Oligo d(T)25 Magnetic Beads (NEB, S1419S) from 20 ug of total RNA. ..

    Incubation:

    Article Title: CCDC174 deficiency impaired human fertility by affecting the alternative splicing of maternal mRNAs.
    Article Snippet: Cells were lysed in NP-40 lysis buffer (50mM Tris, 150mM NaCl, 0.5% NP-40, pH 7.5) with 1% protease inhibitor cocktail (B14001, Bimake) and RNase inhibitor. .. Equal amounts of protein extracts were incubated with Oligo d(T)25 magnetic beads (S1419S, New England BioLabs). ..

    Purification:

    Article Title: Non-gonadal PIWIL1/Aubergine drives regenerative and tumorigenic stem cell proliferation and tumorigenesis in the intestine.
    Article Snippet: .. Polyadenylated RNA was purified from the DNase-treated total RNA using the oligo d(T)25 magnetic beads (NEB, S1419) and used for the library preparation. .. Libraries were cloned using the NEBNext Ultra Directional II RNA Library Prep Kit for Illumina (NEB, E7760), following the manufacturer’s instruction, and amplified by KAPA polymerase using the same primers as for the small RNA sequencing.



    Similar Products

    98
    New England Biolabs oligo d t 25 magnetic beads
    Oligo D T 25 Magnetic Beads, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/oligo+d+t+25+magnetic+beads/Oligo+dT25+Mag+Beads/pm42120494-319-8-13
    Average 98 stars, based on 1 article reviews
    oligo d t 25 magnetic beads - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    98
    New England Biolabs oligo d t 25 magnetic beads selection
    Oligo D T 25 Magnetic Beads Selection, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/oligo+d+t+25+magnetic+beads/Oligo+dT25+Mag+Beads/pm41997935-318-27-32
    Average 98 stars, based on 1 article reviews
    oligo d t 25 magnetic beads selection - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    99
    New England Biolabs e7760 oligo d t 25 magnetic beads neb
    E7760 Oligo D T 25 Magnetic Beads Neb, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/oligo+d+t+25+magnetic+beads/NEBNext+Ultra+II+Directional+RNA+Library+Prep+Kit/pm41894395-234-80-85
    Average 99 stars, based on 1 article reviews
    e7760 oligo d t 25 magnetic beads neb - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    98
    New England Biolabs s1419s
    S1419s, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/oligo+d+t+25+magnetic+beads/Oligo+d(T)25+Magnetic+Beads/pmc12972708-97-9-4
    Average 98 stars, based on 1 article reviews
    s1419s - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    98
    New England Biolabs oligo dt beads
    Oligo Dt Beads, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/oligo+d+t+25+magnetic+beads/Oligo+d(T)25+Magnetic+Beads/pmc12972708-97-0-4
    Average 98 stars, based on 1 article reviews
    oligo dt beads - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    98
    New England Biolabs ab269824 oligo dt beads new england biolabs
    Ab269824 Oligo Dt Beads New England Biolabs, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/oligo+d+t+25+magnetic+beads/Oligo+d(T)25+Magnetic+Beads/pm41816282-135-257-261
    Average 98 stars, based on 1 article reviews
    ab269824 oligo dt beads new england biolabs - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    98
    New England Biolabs oligo dt magnetic beads
    Anti-FLAG slot blot of wildtype (WT) and mutant TOP3B•mRNA covalent intermediates isolated using <t>denaturing</t> <t>oligo-dT</t> magnetic bead pulldown from Neuro2A cells (nitrocellulose membrane). Compared to WT, covalent intermediates produced by the catalytically inactive mutant (Y336F) are reduced, but those produced by the synthetic self-trapping mutant (R338W) are robustly detected. Free mRNA was stained with methylene blue (positively charged nylon membrane) and served as a loading control.
    Oligo Dt Magnetic Beads, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/oligo+d+t+25+magnetic+beads/Oligo+d(T)25+Magnetic+Beads/pmc12971275-90-0-3
    Average 98 stars, based on 1 article reviews
    oligo dt magnetic beads - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    Image Search Results


    Anti-FLAG slot blot of wildtype (WT) and mutant TOP3B•mRNA covalent intermediates isolated using denaturing oligo-dT magnetic bead pulldown from Neuro2A cells (nitrocellulose membrane). Compared to WT, covalent intermediates produced by the catalytically inactive mutant (Y336F) are reduced, but those produced by the synthetic self-trapping mutant (R338W) are robustly detected. Free mRNA was stained with methylene blue (positively charged nylon membrane) and served as a loading control.

    Journal: Bio-protocol

    Article Title: Selective Isolation of TOP3B•mRNA Covalent Intermediates Using Denaturing Oligo-dT Pulldown

    doi: 10.21769/BioProtoc.5627

    Figure Lengend Snippet: Anti-FLAG slot blot of wildtype (WT) and mutant TOP3B•mRNA covalent intermediates isolated using denaturing oligo-dT magnetic bead pulldown from Neuro2A cells (nitrocellulose membrane). Compared to WT, covalent intermediates produced by the catalytically inactive mutant (Y336F) are reduced, but those produced by the synthetic self-trapping mutant (R338W) are robustly detected. Free mRNA was stained with methylene blue (positively charged nylon membrane) and served as a loading control.

    Article Snippet: Oligo-dT magnetic beads (NEB, catalog number: S1419S) 7.

    Techniques: Dot Blot, Mutagenesis, Isolation, Membrane, Produced, Staining, Control